What is the complementary sequence in the mRNA?
The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain. The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.
How many nucleotides are there in the mature mRNA for insulin?
When RNA polymerase initially transcribes the insulin gene into messenger RNA, two introns – totaling 966 additional nucleotides – are included in the precursor form of the insulin mRNA.
What is the minimum length in nucleotides of the protein coding part of the INS gene?
Three is the minimum number of nucleotides per codon needed to encode 20 amino acids.
What is the sequence of complementary DNA strand?
Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded structure by matching base pairs. For example, the complementary sequence to C-A-T-G (where each letter stands for one of the bases in DNA) is G-T-A-C.
What is the sequence of nucleotides present on the strand of the DNA?
Answer. The nucleotide sequence in a sister DNA sequence it replicates will be TACG. The nucleotide sequence in mRNA polynucleotide will be AUGC. This is because the the sequence of mRNA is same as coding strand of DNA but thymine (T) is replaced by uracil (U) in mRNA.
How many nucleotides are there in the RNA that codes for the preproinsulin protein?
Transcription of the preproinsulin gene on the short arm of chromosome 11 (11p15. 5) produces a 600-nucleotide mRNA, which is translated into preproinsulin, an 11.5-kDa protein that is rapidly cleaved by signal peptidases to generate proinsulin.
How many amino acids are in preproinsulin?
110 amino acids
The Endocrine Pancreas and Control of Blood Glucose Like many secreted proteins, insulin is synthesized as a preproinsulin, 110 amino acids long.
How many nucleotides are there in the RNA that codes for the Preproinsulin protein?
How do you write A nucleotide sequence?
In writing nucleotide sequences for nucleic acids, the convention is to write the nucleotides (usually using the one-letter abbreviations for the bases, shown in Figure 19.5 “Structure of a Segment of DNA”) starting with the nucleotide having a free phosphate group, which is known as the 5′ end, and indicate the …
How do you find the complementary nucleotide sequence?
You can determine the sequence of a complementary strand if you are given the sequence of the template strand. These two strands are complementary, with each base in one sticking to its partner on the other. The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.
How is preproinsulin formed?
The gene product preproinsulin is synthesized by polyribosomes bound to the ER of insulin-producing cells (Welsh et al. 1986). When insulin synthesis is activated by high glucose, more message is bound to ER membranes located in the cell cytoplasm.
What is the complementary strand of DNA?
Complementary DNA (cDNA) is a DNA copy of a messenger RNA (mRNA) molecule produced by reverse transcriptase, a DNA polymerase that can use either DNA or RNA as a template.
What is the sequence of the complementary DNA strand?
What is the sequence of the complementary strand of DNA from the 5 to the 3 direction?
According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3′- TACGTACGTACGTACGTACGTACGTACG − 5′. So, the sequence of the complimentary strand in 5′ to 3′ direction is 5′- GCATGCATGCATGCATGCATGCATGCAT− 3′.
How the insulin molecule is synthesized by the processing of preproinsulin?
Biosynthesis of Insulin Insulin is synthesized in significant quantities only in beta cells in the pancreas. The insulin mRNA is translated as a single chain precursor called preproinsulin, and removal of its signal peptide during insertion into the endoplasmic reticulum generates proinsulin.